DCTN3 cDNA

Catalog Number: USB-551911
Article Name: DCTN3 cDNA
Biozol Catalog Number: USB-551911
Supplier Catalog Number: 551911
Alternative Catalog Number: USB-551911-10
Manufacturer: US Biological
Category: Molekularbiologie
DCTN3 encodes the smallest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22kD to 150kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, cytokinesis, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like most other dynactin subunits, exists only as a part of the dynactin complex. It is primarily an alpha-helical protein with very little coiled coil, and binds directly to the largest subunit (p150) of dynactin. Alternative splicing results in multiple transcript variants. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 561bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGGGTCTGACTGACTTGCAGCGGCTACAGGCCCGAGTGGAAGAGCTGGAGCGCTGGGTGTACGGGCCGGGCGGGGCGCGCGGCTCACGGAAGGTGGCTGACGGCCTGGTCAAGGTGCAGGTGGCTTTGGGGAACATTTCCAGCAAGAGGGAGAGGGTGAAGATTCTCTACAAAAAGATTGAAGATCTGATCAAGTACCTGGATCCTGAGTACATCGACCGCATTGCCATACCTGATGCCTCTAAGCTGCAATTCATCCTAGCAGAGGAGCAGTTTATCCTTTCCCAGGTTGCACTCCTGGAGCAGGTGAATGCCTTGGTGCCCATGCTGGACAGTGCTCACATCAAAGCCGTTCCTGAGCATGCTGCCCGCCTGCAGCGCTTGGCCCAGATCCACATTCAGCAGCAGGACCAGTGTGTGGAAATCACTGAGGAGTCCAAGGCTCTCCTGGAGGAATACAACAAGACTACAATGCTTCTCTCCAAGCAATTCGTGCAGTGGGATGAGCTACTTTGCCAGCTAGAGGCCGCCACGCAAGTGAAGCCAGCAGAGGAGTGA Translation Sequence: MAGLTDLQRL QARVEELERW VYGPGGARGS RKVADGLVKV QVALGNISSK RERVKILYKK IEDLIKYLDP EYIDRIAIPD ASKLQFILAE EQFILSQVAL LEQVNALVPM LDSAHIKAVP EHAARLQRLA QIHIQQQDQC VEITEESKAL LEEYNKTTML LSKQFVQWDE LLCQLEAATQ VKPAEE Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 009165
Form: Supplied as a lyophilized powder.