DLX6 is a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. It is in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 528bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAGCCACTCGCAGCACAGCCCTTACCTCCAGTCCTACCACAACAGCAGCGCAGCCGCCCAGACGCGAGGGGACGACACAGATCAACAAAAAACTACAGTGATTGAAAACGGGGAAATCAGGTTCAATGGAAAAGGGAAAAAGATTCGGAAGCCTCGGACCATTTATTCCAGCCTGCAGCTCCAGGCTTTAAACCATCGCTTTCAGCAGACACAGTATCTGGCCCTTCCAGAGAGAGCCGAACTGGCAGCTTCCTTAGGACTGACACAAACACAGGTGAAGATATGGTTTCAGAACAAACGCTCTAAGTTTAAGAAACTGCTGAAGCAGGGCAGTAATCCTCATGAGAGCGACCCCCTCCAGGGCTCGGCGGCCCTGTCGCCACGCTCGCCAGCGCTGCCTCCAGTCTGGGACGTTTCTGCCTCGGCCAAGGGTGTCAGTATGCCCCCCAACAGCTACATGCCTGGCTATTCTCACTGGTACTCCTCTCCACACCAGGACACGATGCAGAGACCACAGATGATGTGA Translation Sequence: MSHSQHSPYL QSYHNSSAAA QTRGDDTDQQ KTTVIENGEI RFNGKGKKIR KPRTIYSSLQ LQALNHRFQQ TQYLALPERA ELAASLGLTQ TQVKIWFQNK RSKFKKLLKQ GSNPHESDPL QGSAALSPRS PALPPVWDVS ASAKGVSMPP NSYMPGYSHW YSSPHQDTMQ RPQMM Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
