DNAL1 is an axonemal dynein light chain which functions as a component of the outer dynein arms complex. This complex acts as the molecular motor that provides the force to move cilia in an ATP-dependent manner. DNAL1 is expressed in tissues with motile cilia or flagella and may be involved in the movement of sperm flagella. Alternate splicing results in multiple transcript variants. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 573bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGAAAGCAACAACAATCAAAGAAGCCTTAGCGAGATGGGAAGAGAAAACTGGCCAGAGGCCATCTGAAGCCAAAGAGATAAAACTTTATGCCCAGATTCCCCCTATAGAGAAGATGGATGCATCCTTGTCCATGCTTGCTAATTGCGAGAAGCTTTCACTGTCTACAAACTGCATTGAAAAAATTGCCAACCTGAATGGCTTAAAAAACTTGAGGATATTATCTTTAGGAAGAAACAACATAAAGAACTTAAATGGACTGGAGGCAGTAGGGGACACATTAGAAGAACTGTGGATCTCCTACAATTTTATTGAGAAGTTGAAAGGGATCCACATAATGAAGAAATTGAAGATTCTCTACATGTCTAATAACCTGGTAAAAGACTGGGCTGAGTTTGTGAAGCTGGCAGAACTGCCATGCCTCGAAGACCTGGTGTTTGTAGGCAATCCCTTGGAAGAGAAACATTCTGCTGAGAATAACTGGATTGAAGAAGCAACCAAGAGAGTGCCCAAACTGAAAAAGCTGGATGGTACTCCAGTAATTAAAGGGGATGAGGAAGAAGACAACTAA Translation Sequence: MAKATTIKEA LARWEEKTGQ RPSEAKEIKL YAQIPPIEKM DASLSMLANC EKLSLSTNCI EKIANLNGLK NLRILSLGRN NIKNLNGLEA VGDTLEELWI SYNFIEKLKG IHIMKKLKIL YMSNNLVKDW AEFVKLAELP CLEDLVFVGN PLEEKHSAEN NWIEEATKRV PKLKKLDGTP VIKGDEEEDN Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
