DNAL4 cDNA

Catalog Number: USB-551925
Article Name: DNAL4 cDNA
Biozol Catalog Number: USB-551925
Supplier Catalog Number: 551925
Alternative Catalog Number: USB-551925-10
Manufacturer: US Biological
Category: Molekularbiologie
DNAL4 encodes an axonemal dynein light chain which functions as a component of the outer dynein arms complex. This complex acts as the molecular motor that provides the force to move cilia in an ATP-dependent manner. The encoded protein is expressed in tissues with motile cilia or flagella and may be involved in the movement of sperm flagella. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 318bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGGAGAAACAGAAGGGAAGAAAGATGAGGCTGATTATAAGCGACTGCAGACCTTCCCTCTGGTCAGGCACTCGGACATGCCAGAGGAGATGCGCGTGGAGACCATGGAGCTATGTGTCACAGCCTGTGAGAAATTCTCCAACAACAACGAGAGCGCCGCCAAGATGATCAAAGAGACAATGGACAAGAAGTTCGGCTCCTCCTGGCACGTGGTGATCGGCGAGGGCTTTGGGTTTGAGATCACCCACGAGGTGAAGAACCTCCTCTACCTGTACTTCGGGGGCACCCTGGCTGTGTGCGTCTGGAAGTGCTCCTGA Translation Sequence: MGETEGKKDE ADYKRLQTFP LVRHSDMPEE MRVETMELCV TACEKFSNNN ESAAKMIKET MDKKFGSSWH VVIGEGFGFE ITHEVKNLLY LYFGGTLAVC VWKCS Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 005731
Form: Supplied as a lyophilized powder.