DYNLL2 cDNA

Catalog Number: USB-551935
Article Name: DYNLL2 cDNA
Biozol Catalog Number: USB-551935
Supplier Catalog Number: 551935
Alternative Catalog Number: USB-551935-10
Manufacturer: US Biological
Category: Molekularbiologie
DYNLL2 (Dynein, Light Chain, LC8-Type 2) is a Protein Coding gene. Among its related pathways are Class I MHC mediated antigen processing and presentation and Vasopressin-regulated water reabsorption. GO annotations related to this gene include cytoskeletal protein binding and motor activity. An important paralog of this gene is DNAL4. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 270bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCTGACCGGAAGGCAGTGATCAAGAACGCAGACATGTCTGAGGACATGCAACAGGATGCCGTTGACTGCGCCACGCAGGCCATGGAGAAGTACAATATAGAGAAGGACATTGCTGCCTATATCAAGAAGGAATTTGACAAGAAATATAACCCTACCTGGCATTGTATCGTGGGCCGAAATTTTGGCAGCTACGTCACACACGAGACAAAGCACTTCATCTATTTTTACTTGGGTCAAGTTGCAATCCTCCTCTTCAAGTCAGGCTAG Translation Sequence: MSDRKAVIKN ADMSEDMQQD AVDCATQAME KYNIEKDIAA YIKKEFDKKY NPTWHCIVGR NFGSYVTHET KHFIYFYLGQ VAILLFKSG Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 542408
Form: Supplied as a lyophilized powder.