EIF1AY is located on the non-recombining region of the Y chromosome. It encodes a protein related to eukaryotic translation initiation factor 1A (EIF1A), which may function in stabilizing the binding of the initiator Met-tRNA to 40S ribosomal subunits. Alternative splicing results in multiple transcript variants. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 435bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCCCAAGAATAAAGGTAAAGGAGGTAAAAACAGGCGCAGGGGTAAAAATGAGAATGAATCTGAAAAAAGAGAGTTGGTGTTTAAAGAGGATGGACAAGAGTATGCTCAGGTAATCAAAATGTTGGGAAATGGACGATTGGAAGCATTGTGTTTTGATGGTGTAAAGAGGTTATGCCATATCAGAGGGAAATTGAGAAAAAAGGTTTGGATAAATACATCAGACATTATATTGGTTGGTCTACGGGACTATCAGGATAACAAAGCTGATGTAATTTTAAAGTACAATGCAGATGAAGCTAGAAGCCTGAAGGCATATGGCGAGCTTCCAGAACATGCTAAAATCAATGAAACAGACACATTTGGTCCTGGAGATGATGATGAAATCCAGTTTGACGATATTGGAGATGATGATGAAGACATTGATGATATCTAA Translation Sequence: MPKNKGKGGK NRRRGKNENE SEKRELVFKE DGQEYAQVIK MLGNGRLEAL CFDGVKRLCHIRGKLRKKVW INTSDIILVG LRDYQDNKAD VILKYNADEA RSLKAYGELP EHAKINETDTFGPGDDDEIQ FDDIGDDDED IDDI Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
