Ubiquitin-like modifier involved in intra-Golgi traffic. Modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1 (By similarity). Involved in autophagy. Plays a role in mitophagy which contributes to regulate mitochondrial quantity and quality by eliminating the mitochondria to a basal level to fulfill cellular energy requirements and preventing excess ROS production. Whereas LC3s are involved in elongation of the phagophore membrane, the GABARAP/GATE-16 subfamily is essential for a later stage in autophagosome maturation. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 354bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAAGTGGATGTTCAAGGAGGACCACTCGCTGGAACACAGATGCGTGGAGTCCGCGAAGATTCGAGCGAAATATCCCGACAGGGTTCCGGTGATTGTGGAAAAGGTCTCAGGCTCTCAGATTGTTGACATTGACAAACGGAAGTACTTGGTTCCATCTGATATCACTGTGGCTCAGTTCATGTGGATCATCAGGAAAAGGATCCAGCTTCCTTCTGAAAAGGCGATCTTCCTGTTTGTGGATAAGACAGTCCCACAGTCCAGCCTAACTATGGGACAGCTTTACGAGAAGGAAAAAGATGAAGATGGATTCTTATATGTGGCCTACAGCGGAGAGAACACTTTTGGCTTCTGA Translation Sequence: MKWMFKEDHS LEHRCVESAK IRAKYPDRVP VIVEKVSGSQ IVDIDKRKYL VPSDITVAQFMWIIRKRIQL PSEKAIFLFV DKTVPQSSLT MGQLYEKEKD EDGFLYVAYS GENTFGF Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.