GEMIN6 cDNA

Catalog Number: USB-551971
Article Name: GEMIN6 cDNA
Biozol Catalog Number: USB-551971
Supplier Catalog Number: 551971
Alternative Catalog Number: USB-551971-10
Manufacturer: US Biological
Category: Molekularbiologie
GEMIN6 is part of a large macromolecular complex, localized to both the cytoplasm and the nucleus, that plays a role in the cytoplasmic assembly of small nuclear ribonucleoproteins (snRNPs). Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 504bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAGTGAATGGATGAAGAAAGGCCCCTTAGAATGGCAAGATTACATTTACAAAGAGGTCCGAGTGACAGCCAGTGAGAAGAATGAGTATAAAGGATGGGTTTTAACTACAGACCCAGTCTCTGCCAATATTGTCCTTGTGAACTTCCTTGAAGATGGCAGCATGTCTGTGACCGGAATTATGGGACATGCTGTGCAGACTGTTGAAACTATGAATGAAGGGGACCATAGAGTGAGGGAGAAGCTGATGCATTTGTTCACGTCTGGAGACTGCAAAGCATACAGCCCAGAGGATCTGGAAGAGAGAAAGAACAGCCTAAAGAAATGGCTTGAGAAGAACCACATCCCCATCACTGAACAGGGAGACGCTCCAAGGACTCTCTGTGTGGCTGGGGTCCTGACTATAGACCCACCATATGGTCCAGAAAATTGCAGCAGCTCTAATGAGATTATTCTGTCGCGTGTTCAGGATCTTATTGAAGGACATCTTACAGCTTCCCAATGA Translation Sequence: MSEWMKKGPL EWQDYIYKEV RVTASEKNEY KGWVLTTDPV SANIVLVNFL EDGSMSVTGI MGHAVQTVET MNEGDHRVRE KLMHLFTSGD CKAYSPEDLE ERKNSLKKWL EKNHIPITEQ GDAPRTLCVA GVLTIDPPYG PENCSSSNEI ILSRVQDLIE GHLTASQ Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 079051
Form: Supplied as a lyophilized powder.