GOLGA7 cDNA

Catalog Number: USB-551983
Article Name: GOLGA7 cDNA
Biozol Catalog Number: USB-551983
Supplier Catalog Number: 551983
Alternative Catalog Number: USB-551983-10
Manufacturer: US Biological
Category: Molekularbiologie
GOLGA7 may be involved in protein transport from Golgi to cell surface. The ZDHHC9-GOLGA7 complex is a palmitoyltransferase specific for HRAS and NRAS. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 414bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAGGCCGCAGCAGGCGCCGGTGTCCGGAAAGGTGTTCATTCAGCGAGACTACAGCAGTGGCACACGCTGCCAGTTCCAGACCAAGTTCCCTGCGGAGCTGGAGAACCGGATTGATAGGCAGCAGTTTGAAGAAACAGTTCGAACTCTAAATAACCTTTATGCAGAAGCAGAGAAGCTCGGCGGCCAGTCATATCTCGAAGGTTGTTTGGCTTGTTTAACAGCATATACCATCTTCCTATGCATGGAAACTCATTATGAGAAGGTTCTGAAGAAAGTCTCCAAATACATTCAAGAGCAGAATGAGAAGATCTATGCTCCACAAGGCCTCCTCCTGACAGACCCTATTGAGCGAGGACTGCGAGTTATTGAAATTACCATTTATGAAGACAGAGGCATGAGCAGTGGAAGATAA Translation Sequence: MRPQQAPVSG KVFIQRDYSS GTRCQFQTKF PAELENRIDR QQFEETVRTL NNLYAEAEKLGGQSYLEGCL ACLTAYTIFL CMETHYEKVL KKVSKYIQEQ NEKIYAPQGL LLTDPIERGLRVIEITIYED RGMSSGR Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 001002296
Form: Supplied as a lyophilized powder.