GSKIP cDNA

Catalog Number: USB-551986
Article Name: GSKIP cDNA
Biozol Catalog Number: USB-551986
Supplier Catalog Number: 551986
Alternative Catalog Number: USB-551986-10
Manufacturer: US Biological
Category: Molekularbiologie
GSKIP encodes a protein that is involved as a negative regulator of GSK3-beta in the Wnt signaling pathway. The encoded protein may play a role in the retinoic acid signaling pathway by regulating the functional interactions between GSK3-beta, beta-catenin and cyclin D1, and it regulates the beta-catenin/N-cadherin pool. The encoded protein contains a GSK3-beta interacting domain (GID) in its C-terminus, which is similar to the GID of Axin. The protein also contains an evolutionarily conserved RII-binding domain, which facilitates binding with protein kinase-A and GSK3-beta, enabling its role as an A-kinase anchoring protein. Alternatively spliced transcript variants have been observed for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 420bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGAAACAGACTGTAATCCCATGGAGCTAAGCAGTATGTCAGGATTTGAAGAAGGTTCAGAGCTGAACGGTTTTGAAGGAACTGACATGAAAGACATGAGGCTCGAAGCTGAAGCAGTTGTAAATGATGTTCTCTTTGCTGTTAACAACATGTTTGTCTCGAAAAGCCTGCGGTGTGCGGATGATGTGGCCTATATCAATGTGGAAACAAAGGAAAGAAACAGATATTGCCTAGAACTCACTGAAGCAGGGCTCAAGGTGGTAGGCTATGCTTTTGACCAGGTAGATGATCATTTACAGACTCCCTACCATGAAACAGTCTACTCCTTGTTGGATACACTCAGCCCCGCCTACCGAGAAGCATTTGGAAACGCACTGCTTCAAAGACTGGAAGCTTTGAAAAGAGATGGACAGTCATGA Translation Sequence: METDCNPMEL SSMSGFEEGS ELNGFEGTDM KDMRLEAEAV VNDVLFAVNN MFVSKSLRCA DDVAYINVET KERNRYCLEL TEAGLKVVGY AFDQVDDHLQ TPYHETVYSL LDTLSPAYRE AFGNALLQRL EALKRDGQS Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 057556
Form: Supplied as a lyophilized powder.