Hemoglobin subunit gamma-2, also known as HBG2, belongs to the fetal hemoglobin subunit, which consists of two alpha chains together with two gamma chains. Increased fetal hemoglobin production in adults can ameliorate the clinical severity of sickle cell disease and beta-thalassemia major. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 444bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGGTCATTTCACAGAGGAGGACAAGGCTACTATCACAAGCCTGTGGGGCAAGGTGAATGTGGAAGATGCTGGAGGAGAAACCCTGGGAAGGCTCCTGGTTGTCTACCCATGGACCCAGAGGTTCTTTGACAGCTTTGGCAACCTGTCCTCTGCCTCTGCCATCATGGGCAACCCCAAAGTCAAGGCACATGGCAAGAAGGTGCTGACTTCCTTGGGAGATGCCATAAAGCACCTGGATGATCTCAAGGGCACCTTTGCCCAGCTGAGTGAACTGCACTGTGACAAGCTGCATGTGGATCCTGAGAACTTCAAGCTCCTGGGAAATGTGCTGGTGACCGTTTTGGCAATCCATTTCGGCAAAGAATTCACCCCTGAGGTGCAGGCTTCCTGGCAGAAGATGGTGACTGGAGTGGCCAGTGCCCTGTCCTCCAGATACCACTGA Translation Sequence: MGHFTEEDKA TITSLWGKVN VEDAGGETLG RLLVVYPWTQ RFFDSFGNLS SASAIMGNPK VKAHGKKVLT SLGDAIKHLD DLKGTFAQLS ELHCDKLHVD PENFKLLGNV LVTVLAIHFG KEFTPEVQAS WQKMVTGVAS ALSSRYH Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
