HEBP1 cDNA

Catalog Number: USB-551996
Article Name: HEBP1 cDNA
Biozol Catalog Number: USB-551996
Supplier Catalog Number: 551996
Alternative Catalog Number: USB-551996-10
Manufacturer: US Biological
Category: Molekularbiologie
HEBP1 is an intracellular tetrapyrrole-binding protein. It includes a natural chemoattractant peptide of 21aa at the N-terminal, which is a natural ligand for formyl peptide receptor-like receptor 2 (FPRL2) and promotes calcium mobilization and chemotaxis in monocytes and dendritic cells. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 570bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTTGGGCATGATCAAGAACTCGCTGTTCGGAAGCGTAGAGACGTGGCCTTGGCAGGTCCTAAGCAAAGGGGACAAGGAAGAAGTTGCCTATGAAGAAAGGGCCTGTGAAGGCGGCAAATTTGCCACAGTAGAAGTGACAGATAAGCCTGTGGATGAGGCTCTACGGGAAGCAATGCCCAAGGTCGCAAAGTATGCGGGGGGCACCAATGACAAGGGAATTGGGATGGGGATGACAGTCCCTATTTCCTTTGCTGTGTTCCCCAATGAAGATGGCTCTCTGCAGAAGAAATTAAAAGTCTGGTTCCGGATTCCAAACCAATTTCAAAGCGACCCACCAGCTCCCAGTGACAAAAGCGTTAAGATTGAGGAACGGGAAGGCATCACTGTCTATTCCATGCAGTTTGGTGGTTATGCCAAGGAAGCAGACTACGTAGCACAAGCCACCCGTCTGCGTGCTGCCCTGGAGGGCACAGCCACCTACCGGGGGGACATCTACTTCTGCACGGGTTATGACCCTCCCATGAAGCCCTACGGACGGCGCAATGAGATCTGGCTGTTGAAGACATGA Translation Sequence: MLGMIKNSLF GSVETWPWQV LSKGDKEEVA YEERACEGGK FATVEVTDKP VDEALREAMP KVAKYAGGTN DKGIGMGMTV PISFAVFPNE DGSLQKKLKV WFRIPNQFQS DPPAPSDKSV KIEEREGITV YSMQFGGYAK EADYVAQATR LRAALEGTAT YRGDIYFCTG YDPPMKPYGR RNEIWLLKT Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 057071
Form: Supplied as a lyophilized powder.