HES2 is a member of the HES family and contains one basic helix-loop-helix (bHLH) domain and one orange domain. The HES family members form a complex with TLE, the mammalian homologue of Groucho, and this interaction is mediated by the carboxy terminal WRPW motif of the HES proteins. Activation of Notch signaling pathway leads to activation of HES family genes through the interaction between Notch intracellular domain and RBPSuH (CSL). HES2 is expressed in a variety of adult and embryonic tissue. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 522bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGGGCTGCCTCGCCGGGCAGGGGACGCGGCGGAGCTGCGCAAGAGCCTGAAGCCGCTGCTGGAGAAGCGCCGGCGCGCGCGCATCAACCAGAGCCTGAGCCAGCTTAAGGGGCTCATCCTGCCGCTGCTGGGCCGGGAGAACTCCAACTGCTCGAAGCTAGAGAAGGCAGACGTCCTGGAAATGACCGTGCGCTTCCTGCAGGAGCTGCCTGCGTCCTCATGGCCCACGGCAGCGCCCCTGCCTTGCGACAGCTACCGCGAGGGCTACAGCGCCTGTGTGGCGCGCCTGGCCCGCGTGCTGCCCGCCTGCCGTGTCCTGGAGCCCGCCGTGAGCGCGCGCCTGCTGGAGCACCTGTGGCGGAGAGCGGCCAGCGCCACCCTGGACGGCGGGCGCGCTGGGGATTCCAGTGGCCCGTCTGCCCCCGCCCCAGCGCCCGCGTCTGCCCCAGAGCCCGCATCCGCTCCGGTGCCCTCGCCGCCCTCGCCTCCCTGCGGCCCTGGCCTCTGGCGGCCGTGGTAG Translation Sequence: MGLPRRAGDA AELRKSLKPL LEKRRRARIN QSLSQLKGLI LPLLGRENSN CSKLEKADVLEMTVRFLQEL PASSWPTAAP LPCDSYREGY SACVARLARV LPACRVLEPA VSARLLEHLWRRAASATLDG GRAGDSSGPS APAPAPASAP EPASAPVPSP PSPPCGPGLW RPW Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.