HES6 encodes a member of a subfamily of basic helix-loop-helix transcription repressors that have homology to the Drosophila enhancer of split genes. Members of this gene family regulate cell differentiation in numerous cell types. HES6 functions as a cofactor, interacting with other transcription factors through a tetrapeptide domain in its C-terminus. Alternatively spliced transcript variants encoding different isoforms have been described. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 675bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGCCACCCGCGGCGCCTGGCCGGGACCGTGTGGGCCGTGAGGATGAGGACGGCTGGGAGACGCGAGGGGACCGCAAGGCCCGGAAGCCCCTGGTGGAGAAGAAGCGGCGCGCGCGGATCAACGAGAGCCTGCAGGAGCTGCGGCTGCTGCTGGCGGGCGCCGAGGTGCAGGCCAAGCTGGAGAACGCCGAAGTGCTGGAGCTGACGGTGCGGCGGGTCCAGGGTGTGCTGCGGGGCCGGGCGCGCGAGCGCGAGCAGCTGCAGGCGGAAGCGAGCGAGCGCTTCGCTGCCGGCTACATCCAGTGCATGCACGAGGTGCACACGTTCGTGTCCACGTGCCAGGCCATCGACGCTACCGTCGCTGCCGAGCTCCTGAACCATCTGCTCGAGTCCATGCCGCTGCGTGAGGGCAGCAGCTTCCAGGATCTGCTGGGGGACGCCCTGGCGGGGCCACCTAGAGCCCCTGGACGGAGTGGCTGGCCTGCGGGGGGCGCTCCGGGATCCCCAATACCCAGCCCCCCGGGTCCTGGGGACGACCTGTGCTCCGACCTGGAGGAGGCCCCTGAGGCTGAACTGAGTCAGGCTCCTGCTGAGGGGCCCGACTTGGTGCCCGCAGCCCTGGGCAGCCTGACCACAGCCCAAATTGCCCGGAGTGTCTGGAGGCCTTGGTGA Translation Sequence: MAPPAAPGRD RVGREDEDGW ETRGDRKARK PLVEKKRRAR INESLQELRL LLAGAEVQAKLENAEVLELT VRRVQGVLRG RAREREQLQA EASERFAAGY IQCMHEVHTF VSTCQAIDATVAAELLNHLL ESMPLREGSS FQDLLGDALA GPPRAPGRSG WPAGGAPGSP IPSPPGPGDDLCSDLEEAPE AELSQAPAEG PDLVPAALGS LTTAQIARSV WRPW Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.