IMP3 cDNA

Catalog Number: USB-552030
Article Name: IMP3 cDNA
Biozol Catalog Number: USB-552030
Supplier Catalog Number: 552030
Alternative Catalog Number: USB-552030-10
Manufacturer: US Biological
Category: Molekularbiologie
IMP3 encodes the human homolog of the yeast Imp3 protein. The protein localizes to the nucleoli and interacts with the U3 snoRNP complex. The protein contains an S4 domain. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 555bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGTGCGGAAGCTTAAGTTCCACGAGCAGAAGCTGCTGAAGCAGGTGGACTTCCTGAACTGGGAGGTCACCGACCACAACCTGCACGAGCTGCGCGTGCTGCGGCGTTACCGGCTGCAGCGGCGGGAGGACTACACGCGCTACAACCAGCTGAGCCGTGCCGTGCGTGAGCTGGCGCGGCGCCTGCGCGACCTGCCCGAACGCGACCAGTTCCGCGTGCGCGCTTCGGCCGCGCTGCTGGACAAGCTGTATGCTCTCGGCTTGGTGCCCACGCGCGGTTCGCTGGAGCTCTGCGACTTCGTCACGGCCTCGTCCTTCTGCCGCCGCCGCCTCCCCACCGTGCTCCTCAAGCTGCGCATGGCGCAGCACCTTCAGGCTGCCGTGGCCTTTGTGGAGCAAGGGCACGTACGCGTGGGCCCTGACGTGGTTACCGACCCCGCCTTCCTTGTCACGCGCAGCATGGAGGACTTTGTCACTTGGGTGGACTCGTCCAAGATCAAGCGGCACGTGCTAGAGTACAATGAGGAGCGCGATGACTTCGATCTGGAAGCCTAG Translation Sequence: MVRKLKFHEQ KLLKQVDFLN WEVTDHNLHE LRVLRRYRLQ RREDYTRYNQ LSRAVRELAR RLRDLPERDQ FRVRASAALL DKLYALGLVP TRGSLELCDF VTASSFCRRR LPTVLLKLRM AQHLQAAVAF VEQGHVRVGP DVVTDPAFLV TRSMEDFVTW VDSSKIKRHV LEYNEERDDF DLEA Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 060755
Form: Supplied as a lyophilized powder.