LMO4 encodes a cysteine-rich protein that contains two LIM domains but lacks a DNA-binding homeodomain. The encoded protein may play a role as a transcriptional regulator or as an oncogene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 498bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGTGAATCCGGGCAGCAGCTCGCAGCCGCCCCCGGTGACGGCCGGCTCCCTCTCCTGGAAGCGGTGCGCAGGCTGCGGGGGCAAGATTGCGGACCGCTTTCTGCTCTATGCCATGGACAGCTATTGGCACAGCCGGTGCCTCAAGTGCTCCTGCTGCCAGGCGCAGCTGGGCGACATCGGCACGTCCTGTTACACCAAAAGTGGCATGATCCTTTGCAGAAATGACTACATTAGGTTATTTGGAAATAGCGGTGCTTGCAGCGCTTGCGGACAGTCGATTCCTGCGAGTGAACTCGTCATGAGGGCGCAAGGCAATGTGTATCATCTTAAGTGTTTTACATGCTCTACCTGCCGGAATCGCCTGGTCCCGGGAGATCGGTTTCACTACATCAATGGCAGTTTATTTTGTGAACATGATAGACCTACAGCTCTCATCAATGGCCATTTGAATTCACTTCAGAGCAATCCACTACTGCCAGACCAGAAGGTCTGCTAA Translation Sequence: MVNPGSSSQP PPVTAGSLSW KRCAGCGGKI ADRFLLYAMD SYWHSRCLKC SCCQAQLGDI GTSCYTKSGM ILCRNDYIRL FGNSGACSAC GQSIPASELV MRAQGNVYHL KCFTCSTCRN RLVPGDRFHY INGSLFCEHD RPTALINGHL NSLQSNPLLP DQKVC Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.