LSM4 encodes a member of the LSm family of RNA-binding proteins. LSm proteins form stable heteromers that bind specifically to the 3-terminal oligo (U) tract of U6 snRNA and may play a role in pre-mRNA splicing by mediating U4/U6 snRNP formation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 420bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCTTCCCTTGTCACTGCTGAAGACGGCTCAGAATCACCCCATGTTGGTGGAGCTGAAAAATGGGGAGACGTACAATGGACACCTGGTGAGCTGCGACAACTGGATGAACATTAACCTGCGAGAAGTCATCTGCACGTCCAGGGACGGGGACAAGTTCTGGCGGATGCCCGAGTGCTACATCCGCGGCAGCACCATCAAGTACCTGCGCATCCCCGACGAGATCATCGACATGGTCAAGGAGGAGGTGGTGGCCAAGGGCCGCGGCCGCGGAGGCCTGCAGCAGCAGAAGCAGCAGAAAGGCCGCGGCATGGGCGGCGCTGGCCGAGGTGTGTTTGGTGGCCGGGGCCGAGGTGGGATCCCGGGCACAGGCAGAGGCCAGCCAGAGAAGAAGCCTGGCAGACAGGCGGGCAAACAGTGA Translation Sequence: MLPLSLLKTA QNHPMLVELK NGETYNGHLV SCDNWMNINL REVICTSRDG DKFWRMPECY IRGSTIKYLR IPDEIIDMVK EEVVAKGRGR GGLQQQKQQK GRGMGGAGRG VFGGRGRGGI PGTGRGQPEK KPGRQAGKQ Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.