MAFF cDNA

Catalog Number: USB-552067
Article Name: MAFF cDNA
Biozol Catalog Number: USB-552067
Supplier Catalog Number: 552067
Alternative Catalog Number: USB-552067-10
Manufacturer: US Biological
Category: Molekularbiologie
MAFF is a basic leucine zipper (bZIP) transcription factor that lacks a transactivation domain. It is known to bind the US-2 DNA element in the promoter of the oxytocin receptor (OTR) gene and most likely heterodimerizes with other leucine zipper-containing proteins to enhance expression of the OTR gene during term pregnancy. Multiple transcript variants encoding two different isoforms have been found for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 495bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCTGTGGATCCCCTATCCAGCAAAGCTCTAAAGATCAAGCGAGAGCTGAGCGAGAACACGCCGCACCTGTCGGACGAGGCGCTGATGGGGCTGTCGGTGCGCGAGCTGAACCGGCATCTGCGCGGGCTCTCCGCCGAGGAGGTGACACGGCTCAAGCAGCGGCGCCGCACACTCAAAAACCGTGGCTACGCCGCCAGCTGCCGCGTGAAGCGCGTGTGCCAGAAGGAGGAGCTGCAGAAGCAGAAGTCGGAGCTGGAGCGCGAGGTGGACAAGCTGGCGCGCGAGAACGCCGCCATGCGCCTGGAGCTCGACGCGCTGCGCGGCAAGTGCGAGGCGCTGCAGGGCTTCGCGCGCTCCGTGGCCGCCGCCCGCGGGCCCGCCACGCTCGTGGCGCCGGCCAGCGTCATCACCATCGTCAAGTCCACCCCGGGCTCGGGGTCTGGCCCCGCCCACGGCCCGGACCCCGCCCACGGCCCGGCCTCCTGCTCCTAG Translation Sequence: MSVDPLSSKA LKIKRELSEN TPHLSDEALM GLSVRELNRH LRGLSAEEVT RLKQRRRTLK NRGYAASCRV KRVCQKEELQ KQKSELEREV DKLARENAAM RLELDALRGK CEALQGFARS VAAARGPATL VAPASVITIV KSTPGSGSGP AHGPDPAHGP ASCS Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 001155045
Form: Supplied as a lyophilized powder.