MCTS1 cDNA

Catalog Number: USB-552077
Article Name: MCTS1 cDNA
Biozol Catalog Number: USB-552077
Supplier Catalog Number: 552077
Alternative Catalog Number: USB-552077-10
Manufacturer: US Biological
Category: Molekularbiologie
MCTS1 (malignant T cell amplified sequence 1), also known as MCT1, is a 181aa protein that is ubiquitously expressed and localizes to the cytoplasm of cells. MCTS1 may play a role in cell cycle regulation by decreasing cell doubling time and by shortening the duration of G1 transit time and G1/S transition. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 546bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTTCAAGAAATTTGATGAAAAAGAAAATGTGTCCAACTGCATCCAGTTGAAAACTTCAGTTATTAAGGGTATTAAGAATCAATTGATAGAGCAATTTCCAGGTATTGAACCATGGCTTAATCAAATCATGCCTAAGAAAGATCCTGTCAAAATAGTCCGATGCCATGAACATATAGAAATCCTTACAGTAAATGGAGAATTACTCTTTTTTAGACAAAGAGAAGGGCCTTTTTATCCAACCCTAAGATTACTTCACAAATATCCTTTTATCCTGCCACACCAGCAGGTTGATAAAGGAGCCATCAAATTTGTACTCAGTGGAGCAAATATCATGTGTCCAGGCTTAACTTCTCCTGGAGCTAAGCTTTACCCTGCTGCAGTAGATACCATTGTTGCTATCATGGCAGAAGGAAAACAGCATGCTCTATGTGTTGGAGTCATGAAGATGTCTGCAGAAGACATTGAGAAAGTCAACAAAGGAATTGGCATTGAAAATATCCATTATTTAAATGATGGGCTGTGGCATATGAAGACATATAAATGA Translation Sequence: MFKKFDEKEN VSNCIQLKTS VIKGIKNQLI EQFPGIEPWL NQIMPKKDPV KIVRCHEHIEILTVNGELLF FRQREGPFYP TLRLLHKYPF ILPHQQVDKG AIKFVLSGAN IMCPGLTSPGAKLYPAAVDT IVAIMAEGKQ HALCVGVMKM SAEDIEKVNK GIGIENIHYL NDGLWHMKTYK Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 054779
Form: Supplied as a lyophilized powder.