MRPS25 cDNA

Catalog Number: USB-552092
Article Name: MRPS25 cDNA
Biozol Catalog Number: USB-552092
Supplier Catalog Number: 552092
Alternative Catalog Number: USB-552092-10
Manufacturer: US Biological
Category: Molekularbiologie
MRP-S25 (mitochondrial 28S ribosomal protein S25), also known as S25mt, is a 173aa mitochondrial ribosomal protein belonging to the ribosomal protein S25/L51 family. Localized to mitochondria, MRP-S25 is present in the 28S subunit of the mitoribosomes. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 522bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCCCATGAAGGGCCGCTTCCCCATCCGCCGCACCCTGCAATATCTGAGCCAGGGGAACGTGGTGTTCAAGGACTCCGTGAAGGTCATGACAGTGAATTACAACACGCATGGGGAGCTGGGCGAGGGCGCCAGGAAGTTTGTGTTTTTCAACATACCTCAGATTCAATACAAAAACCCTTGGGTGCAGATCATGATGTTTAAGAACATGACGCCGTCACCCTTCCTGCGATTCTACTTAGATTCTGGGGAGCAGGTCCTGGTGGATGTGGAGACCAAGAGCAATAAGGAGATCATGGAGCACATCAGAAAAATCTTGGGGAAGAATGAGGAAACCCTCAGGGAAGAGGAGGAGGAGAAAAAGCAGCTTTCTCACCCAGCCAACTTCGGCCCTCGAAAGTACTGCCTGCGGGAGTGCATCTGTGAAGTGGAAGGGCAGGTGCCCTGCCCCAGCCTGGTGCCATTACCCAAGGAGATGAGGGGGAAGTACAAAGCCGCTCTGAAAGCCGATGCCCAGGACTAA Translation Sequence: MPMKGRFPIR RTLQYLSQGN VVFKDSVKVM TVNYNTHGEL GEGARKFVFF NIPQIQYKNP WVQIMMFKNM TPSPFLRFYL DSGEQVLVDV ETKSNKEIME HIRKILGKNE ETLREEEEEK KQLSHPANFG PRKYCLRECI CEVEGQVPCP SLVPLPKEMR GKYKAALKAD AQD Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 071942
Form: Supplied as a lyophilized powder.