MT2A cDNA

Catalog Number: USB-552096
Article Name: MT2A cDNA
Biozol Catalog Number: USB-552096
Supplier Catalog Number: 552096
Alternative Catalog Number: USB-552096-10
Manufacturer: US Biological
Category: Molekularbiologie
MT2A (Metallothionein 2A) belongs to lncRNA RNA class. Diseases associated with MT2A include cerebral lymphoma and prostate cancer. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 186bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGATCCCAACTGCTCCTGCGCCGCCGGTGACTCCTGCACCTGCGCCGGCTCCTGCAAATGCAAAGAGTGCAAATGCACCTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCTGTGGGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCGTCGGACAAGTGCAGCTGCTGCGCCTGA Translation Sequence: MDPNCSCAAG DSCTCAGSCK CKECKCTSCK KSCCSCCPVG CAKCAQGCIC KGASDKCSCCA Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 005944
Form: Supplied as a lyophilized powder.