MXD3 encodes a member of the Myc superfamily of basic helix-loop-helix leucine zipper transcriptional regulators. It forms a heterodimer with the cofactor MAX which binds specific E-box DNA motifs in the promoters of target genes and regulates their transcription. Disruption of the MAX-MXD3 complex is associated with uncontrolled cell proliferation and tumorigenesis. Transcript variants of this gene encoding different isoforms have been described. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 621bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGAACCCTTGGCCAGCAACATCCAGGTCCTGCTGCAGGCGGCCGAGTTCCTGGAGCGCCGTGAGAGAGAGGCCGAGCATGGTTATGCGTCCCTGTGCCCGCATCGCAGTCCAGGCCCCATCCACAGGAGGAAGAAGCGACCCCCCCAGGCTCCTGGCGCGCAGGACAGCGGGCGGTCAGTGCACAATGAACTGGAGAAGCGCAGGAGGGCCCAGTTGAAGCGGTGCCTGGAGCGGCTGAAGCAGCAGATGCCCCTGGGGGCCGACTGTGCCCGGTACACCACGCTGAGCCTGCTGCGCCGTGCCAGGATGCACATCCAGAAGCTGGAGGATCAGGAGCAGCGGGCCCGACAGCTCAAGGAGAGGCTGCGCAGCAAGCAGCAGAGCCTGCAGCGGCAGCTGGAGCAGCTCCGGGGGCTGGCAGGGGCGGCCGAGCGGGAGCGGCTGCGGGCGGACAGTCTGGACTCCTCAGGCCTCTCCTCTGAGCGCTCAGACTCAGACCAAGAGGAGCTGGAGGTGGATGTGGAGAGCCTGGTGTTTGGGGGTGAGGCCGAGCTGCTGCGGGGCTTCGTCGCCGGCCAGGAGCACAGCTACTCGCACGGCGGCGGCGCCTGGCTATGA Translation Sequence: MEPLASNIQV LLQAAEFLER REREAEHGYA SLCPHRSPGP IHRRKKRPPQ APGAQDSGRS VHNELEKRRR AQLKRCLERL KQQMPLGADC ARYTTLSLLR RARMHIQKLE DQEQRARQLK ERLRSKQQSL QRQLEQLRGL AGAAERERLR ADSLDSSGLS SERSDSDQEE LEVDVESLVF GGEAELLRGF VAGQEHSYSH GGGAWL Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
