MZB1 acts as a hormone-regulated adipokine/proinflammatory cytokine that is implicated in causing chronic inflammation, affecting cellular expansion and blunting insulin response in adipocytes. This protein may have a role in the onset of insulin resistance. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 294bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAGGCTGTCACTGCCACTGCTGCTGCTGCTGCTGGGAGCCTGGGCCATCCCAGGGGGCCTCGGGGACAGGGCGCCACTCACAGCCACAGCCCCACAACTGGATGATGAGGAGATGTACTCAGCCCACATGCCCGCTCACCTGCGCTGTGATGCCTGCAGAGCTGTGGCTTACCAGATGTGGCAAAATCTGGCAAAGGCAGAGACCAAACTTCATACCTCAAACTCTGGGGGGCGGCGGGAGCTGAGCGAGTTGGTCTACACGGATGTCCTGGACCGGAGCTGCTCCCGGAACTGGCAGGACTACGGAGTTCGAGAAGTGGACCAAGTGAAACGTCTCACAGGCCCAGGACTTAGCGAGGGGCCAGAGCCAAGCATCAGCGTGATGGTCACAGGGGGCCCCTGGCCTACCAGGCTCTCCAGGACATGTTTGCACTACTTGGGGGAGTTTGGAGAAGACCAGATCTATGAAGCCCACCAACAAGGCCGAGGGGCTCTGGAGGCATTGCTATGTGGGGGACCCCAGGGGGCCTGCTCAGAGAAGGTGTCAGCCACAAGAGAAGAGCTCTAG Translation Sequence: MRLSLPLLLL LLGAWAIPGG LGDRAPLTAT APQLDDEEMY SAHMPAHLRC DACRAVAYQM WQNLAKAETK LHTSNSGGRR ELSELVYTDV LDRSCSRNWQ DYGVREVDQV KRLTGPGLSE GPEPSISVMV TGGPWPTRLS RTCLHYLGEF GEDQIYEAHQ QGRGALEALL CGGPQGACSE KVSATREEL Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
