The product of NCBP2 is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5 cap of nascent pre-mRNA in the nucleoplasm. The encoded protein has an RNP domain commonly found in RNA binding proteins, and contains the cap-binding activity. The CBC promotes pre-mRNA splicing, 3-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. Multiple transcript variants encoding different isoforms have been found for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 471bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGACTCCTACGTGGAGCTGAGCCAGTACCGGGACCAGCACTTCCGGGGTGACAATGAAGAACAAGAAAAATTACTGAAGAAAAGCTGTACGTTATATGTTGGAAATCTTTCTTTTTACACAACTGAAGAACAAATCTATGAACTCTTCAGCAAAAGTGGTGACATAAAGAAAATCATTATGGGTCTGGATAAAATGAAGAAAACAGCATGTGGATTCTGTTTTGTGGAATATTACTCACGCGCAGATGCGGAAAACGCCATGCGGTACATAAATGGGACGCGTCTGGATGACCGAATCATTCGCACAGACTGGGACGCAGGCTTTAAGGAGGGCAGGCAATACGGCCGTGGGCGATCTGGGGGCCAGGTTCGGGATGAGTATCGGCAGGACTACGATGCTGGGAGAGGAGGCTATGGAAAACTGGCACAGAACCAGTGA Translation Sequence: MSGGLLKALR SDSYVELSQY RDQHFRGDNE EQEKLLKKSC TLYVGNLSFY TTEEQIYELF SKSGDIKKII MGLDKMKKTA CGFCFVEYYS RADAENAMRY INGTRLDDRI IRTDWDAGFK EGRQYGRGRS GGQVRDEYRQ DYDAGRGGYG KLAQNQ Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.