NDUFA5 cDNA

Catalog Number: USB-552115
Article Name: NDUFA5 cDNA
Biozol Catalog Number: USB-552115
Supplier Catalog Number: 552115
Alternative Catalog Number: USB-552115-10
Manufacturer: US Biological
Category: Molekularbiologie
NDUFA5 encodes a conserved protein that comprises the B13 subunit of complex I of the mitochondrial respiratory chain. This localizes to the inner mitochondrial membrane, where it is thought to aid in the transfer of electrons from NADH to ubiquinone. Alternative splicing results in multiple transcript variants. There are numerous pseudogenes of this gene on chromosomes 1, 3, 6, 8, 9, 11, 12, and 16. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 351bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGGGTGTGCTGAAGAAGACCACTGGCCTTGTGGGATTGGCTGTGTGCAATACTCCTCACGAGAGGCTAAGAATATTGTACACAAAGATTCTTGATGTTCTTGAGGAAATCCCTAAAAATGCAGCATATAGAAAGTATACAGAACAGATTACAAATGAGAAGCTGGCTATGGTTAAAGCGGAACCAGATGTTAAAAAATTAGAAGACCAACTTCAAGGCGGTCAATTAGAAGAGGTGATTCTTCAGGCTGAACATGAACTAAATCTGGCAAGAAAAATGAGGGAATGGAAACTATGGGAGCCATTAGTGGAAGAGCCTCCTGCCGATCAGTGGAAATGGCCAATATAA Translation Sequence: MAGVLKKTTG LVGLAVCNTP HERLRILYTK ILDVLEEIPK NAAYRKYTEQ ITNEKLAMVK AEPDVKKLED QLQGGQLEEV ILQAEHELNL ARKMREWKLW EPLVEEPPAD QWKWPI Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 004991
Form: Supplied as a lyophilized powder.