NDUFAF3 encodes a mitochondrial complex I assembly protein that interacts with complex I subunits. Mutations in this gene cause mitochondrial complex I deficiency, a fatal neonatal disorder of the oxidative phosphorylation system. Alternatively spliced transcript variants encoding different isoforms have been identified. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 555bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCCACCGCTCTCGCGCTACGTAGCTTGTACCGAGCGCGACCCTCGCTGCGCTGTCCGCCCGTTGAGCTTCCCTGGGCCCCGCGGCGAGGGCATCGGCTCTCGCCGGCGGATGACGAGCTGTATCAGCGGACGCGCATCTCTCTGCTGCAACGCGAGGCCGCTCAGGCAATGTACATCGACAGCTACAACAGCCGCGGCTTCATGATAAACGGAAACCGCGTGCTCGGCCCCTGCGCTCTGCTCCCGCACTCGGTGGTGCAGTGGAACGTGGGATCCCACCAGGACATCACCGAAGACAGCTTTTCCCTCTTCTGGTTGCTGGAGCCCCGGATAGAGATCGTGGTGGTGGGGACTGGAGACCGGACCGAGAGGCTGCAGTCCCAGGTGCTTCAAGCCATGAGGCAGCGGGGCATTGCTGTGGAAGTGCAGGACACGCCCAATGCCTGTGCCACCTTCAACTTCCTGTGTCATGAAGGCCGAGTAACTGGAGCTGCTCTCATCCCTCCACCAGGAGGGACTTCACTTACATCTTTGGGCCAAGCTGCTCAATGA Translation Sequence: MATALALRSL YRARPSLRCP PVELPWAPRR GHRLSPADDE LYQRTRISLL QREAAQAMYI DSYNSRGFMI NGNRVLGPCA LLPHSVVQWN VGSHQDITED SFSLFWLLEP RIEIVVVGTG DRTERLQSQV LQAMRQRGIA VEVQDTPNAC ATFNFLCHEG RVTGAALIPP PGGTSLTSLG QAAQ Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
