The protein encoded by NFYB is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds with high specificity to CCAAT motifs in the promoter regions in a variety of genes. NFYB product, subunit B, forms a tight dimer with the C subunit, a prerequisite for subunit A association. The resulting trimer binds to DNA with high specificity and affinity. Subunits B and C each contain a histone-like motif. Observation of the histone nature of these subunits is supported by two types of evidence, protein sequence alignments and experiments with mutants. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 624bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGACAATGGATGGTGACAGTTCTACAACAGATGCTTCTCAACTAGGAATCTCTGCAGACTATATTGGAGGAAGTCATTATGTTATACAGCCTCATGATGATACTGAGGACAGCATGAATGATCATGAAGACACAAATGGTTCAAAAGAAAGTTTCAGAGAACAAGATATATATCTTCCAATAGCAAACGTGGCTAGGATAATGAAAAATGCCATACCTCAAACGGGAAAGATTGCAAAAGATGCCAAAGAATGTGTTCAAGAATGTGTAAGTGAGTTCATCAGTTTTATAACATCTGAAGCAAGTGAAAGGTGCCATCAAGAGAAACGGAAAACAATCAATGGAGAAGATATTCTCTTTGCTATGTCTACTTTAGGCTTTGACAGTTATGTGGAACCTCTGAAATTATACCTTCAGAAATTCAGAGAGGCTATGAAAGGAGAAAAGGGAATTGGTGGAGCAGTCACAGCTACAGATGGACTAAGTGAAGAGCTTACAGAGGAGGCATTTACTAACCAGTTACCAGCTGGCTTAATAACCACAGACGGTCAACAACAAAATGTTATGGTTTACACAACATCATATCAACAGATTTCTGGTGTTCAGCAAATTCAGTTTTCATGA Translation Sequence: MTMDGDSSTT DASQLGISAD YIGGSHYVIQ PHDDTEDSMN DHEDTNGSKE SFREQDIYLPIANVARIMKN AIPQTGKIAK DAKECVQECV SEFISFITSE ASERCHQEKR KTINGEDILFAMSTLGFDSY VEPLKLYLQK FREAMKGEKG IGGAVTATDG LSEELTEEAF TNQLPAGLITTDGQQQNVMV YTTSYQQISG VQQIQFS Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
