NHLH2 (Nescient Helix Loop Helix 2) serve as DNA-binding protein and may be involved in the control of cell-type determination, possibly within the developing nervous system. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 408bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGATGCTGAGTCCGGACCAAGCAGCAGATTCGGACCATCCCAGCTCGGCGCACTCGGATCCGGAGTCCCTGGGCGGCACGGACACCAAGGTGCTCGGCAGCGTGTCGGACCTGGAGCCGGTGGAGGAGGCCGAGGGCGACGGCAAGGGCGGCAGCCGAGCCGCGCTCTACCCGCACCCGCAGCAGCTGAGCCGCGAGGAGAAGCGCCGCCGCCGGCGCGCCACGGCCAAGTACCGCTCGGCCCACGCCACCCGCGAGCGCATCCGCGTGGAAGCCTTCAACTTGGCCTTCGCCGAGCTCCGCAAATTGCTGCCCACGCTGCCCCCGGACAAGAAGCTCTCCAAGATCGAGATCCTGCGCCTGGCCATCTGCTACATCTCCTATCTCAACCACGTCCTGGACGTGTAG Translation Sequence: MMLSPDQAAD SDHPSSAHSD PESLGGTDTK VLGSVSDLEP VEEAEGDGKG GSRAALYPHPQQLSREEKRR RRRATAKYRS AHATRERIRV EAFNLAFAEL RKLLPTLPPD KKLSKIEILRLAICYISYLN HVLDV Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.