NHP2 cDNA

Catalog Number: USB-552126
Article Name: NHP2 cDNA
Biozol Catalog Number: USB-552126
Supplier Catalog Number: 552126
Alternative Catalog Number: USB-552126-10
Manufacturer: US Biological
Category: Molekularbiologie
NHP2 is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA1 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. The four H/ACA snoRNP proteins are also components of the telomerase complex. This gene encodes a protein related to Saccharomyces cerevisiae Nhp2p. Alternative splicing results in multiple transcript variants. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 462bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGACCAAAATAAAGGCAGATCCCGACGGGCCCGAGGCTCAGGCGGAGGCGTGTTCCGGGGAGCGCACCTACCAGGAGCTGCTGGTCAACCAGAACCCCATCGCGCAGCCCCTGGCTTCTCGCCGCCTCACGCGGAAGCTCTACAAATGCATCAAGAAAGCGGTGAAGCAGAAGCAGATTCGGCGCGGGGTGAAAGAGGTTCAGAAATTTGTCAACAAAGGAGAAAAAGGGATCATGGTTTTGGCAGGAGACACACTGCCCATTGAGGTATACTGCCATCTCCCAGTCATGTGTGAGGACCGAAATTTGCCCTATGTCTATATCCCCTCTAAGACGGACCTGGGTGCAGCCGCAGGCTCCAAGCGCCCCACCTGTGTGATAATGGTCAAGCCCCATGAGGAGTACCAGGAGGCTTACGATGAGTGCCTGGAGGAGGTGCAGTCCCTGCCCCTACCCCTATGA Translation Sequence: MTKIKADPDG PEAQAEACSG ERTYQELLVN QNPIAQPLAS RRLTRKLYKC IKKAVKQKQI RRGVKEVQKF VNKGEKGIMV LAGDTLPIEV YCHLPVMCED RNLPYVYIPS KTDLGAAAGS KRPTCVIMVK PHEEYQEAYD ECLEEVQSLP LPL Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 060308
Form: Supplied as a lyophilized powder.