Originally named because of its sequence similarity to the Saccharomyces cerevisiae NHP2 (non-histone protein 2), NHP2L1 appears to be a highly conserved nuclear protein that is a component of the [U4/U6. U5] tri-snRNP. It binds to the 5 stem-loop of U4 snRNA. Two transcript variants encoding the same protein have been found for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 387bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGACTGAGGCTGATGTGAATCCAAAGGCCTATCCCCTTGCCGATGCCCACCTCACCAAGAAGCTACTGGACCTCGTTCAGCAGTCATGTAACTATAAGCAGCTTCGGAAAGGAGCCAATGAGGCCACCAAAACCCTCAACAGGGGCATCTCTGAGTTCATCGTGATGGCTGCAGACGCCGAGCCACTGGAGATCATTCTGCACCTGCCGCTGCTGTGTGAAGACAAGAATGTGCCCTACGTGTTTGTGCGCTCCAAGCAGGCCCTGGGGAGAGCCTGTGGGGTCTCCAGGCCTGTCATCGCCTGTTCTGTCACCATCAAAGAAGGCTCGCAGCTGAAACAGCAGATCCAATCCATTCAGCAGTCCATTGAAAGGCTCTTAGTCTAA Translation Sequence: MTEADVNPKA YPLADAHLTK KLLDLVQQSC NYKQLRKGAN EATKTLNRGI SEFIVMAADA EPLEIILHLP LLCEDKNVPY VFVRSKQALG RACGVSRPVI ACSVTIKEGS QLKQQIQSIQ QSIERLLV Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
