NUTF2 cDNA

Catalog Number: USB-552141
Article Name: NUTF2 cDNA
Biozol Catalog Number: USB-552141
Supplier Catalog Number: 552141
Alternative Catalog Number: USB-552141-10
Manufacturer: US Biological
Category: Molekularbiologie
NUTF2 encoded by this gene is a cytosolic factor that facilitates protein transport into the nucleus. It interacts with the nuclear pore complex glycoprotein p62. This encoded protein acts at a relative late stage of nuclear protein import, subsequent to the initial docking of nuclear import ligand at the nuclear envelope. It is thought to be part of a multicomponent system of cytosolic factors that assemble at the pore complex during nuclear import. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 384bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGGAGACAAGCCAATTTGGGAGCAGATTGGATCCAGCTTCATTCAACATTACTACCAGTTATTTGATAATGATAGAACCCAACTAGGCGCAATTTACATTGACGCGTCATGCCTTACGTGGGAAGGACAACAGTTCCAGGGGAAAGCTGCCATTGTGGAGAAGTTGTCTAGCCTTCCGTTCCAGAAAATTCAGCACAGCATCACCGCGCAGGACCATCAGCCCACTCCAGATAGCTGCATCATCAGCATGGTTGTGGGCCAGCTTAAGGCGGATGAAGACCCCATCATGGGGTTCCACCAGATGTTCCTATTAAAGAACATCAACGATGCTTGGGTTTGCACCAATGACATGTTCAGGCTCGCCCTGCACAACTTTGGCTGA Translation Sequence: MGDKPIWEQI GSSFIQHYYQ LFDNDRTQLG AIYIDASCLT WEGQQFQGKA AIVEKLSSLP FQKIQHSITA QDHQPTPDSC IISMVVGQLK ADEDPIMGFH QMFLLKNIND AWVCTNDMFR LALHNFG Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 005787
Form: Supplied as a lyophilized powder.