NXT1 cDNA

Catalog Number: USB-552142
Article Name: NXT1 cDNA
Biozol Catalog Number: USB-552142
Supplier Catalog Number: 552142
Alternative Catalog Number: USB-552142-10
Manufacturer: US Biological
Category: Molekularbiologie
NXT1 encoded by this gene is located in the nuclear envelope. NXT1 has protein similarity to nuclear transport factor 2. NXT1 functions as a nuclear export factor in both RAN (Ras-related nuclear protein) - and CRM1 (required for chromosome region maintenance) -dependent pathways. It is found to stimulate the export of U1 snRNA in RAN- and CRM1-dependent pathways and the export of tRNA and mRNA in a CRM1-independent pathway. The encoded protein heterodimerizes with Tap protein and may regulate the ability of Tap protein to mediate nuclear mRNA export. The use of alternate polyadenylation sites has been found for NXT1. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 558bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCTCCCAGCCTTCAGGAAGGCGCTCAGCTCGGGGAAAACAAACCCTCAACTTGCTCCTTTTCAATTGAGAGAATCTTAGGACTGGACCAGAAGAAAGACTGTGTTCCATTAATGAAACCCCACAGGCCCTGGGCAGACACCTGCAGCTCATCAGGGAAAGATGGTAACTTATGTCTACATGTCCCAAATCCTCCCAGTGGGATTTCATTCCCTAGCGTGGTGGATCACCCAATGCCAGAAGAAAGAGCTTCGAAATATGAAAATTACTTTTCAGCCTCAGAAAGACTGTCTTTGAAAAGAGAGTTGAGTTGGTATAGAGGCCGAAGACCAAGAACTGCTTTTACTCAAAACCAGATTGAAGTGTTAGAAAATGTCTTTAGAGTAAACTGCTATCCTGGTATCGATATTAGAGAAGACTTAGCTCAAAAATTGAATCTAGAGGAAGACAGAATCCAGATTTGGTTTCAAAATCGGCGTGCAAAACTGAAAAGGTCCCATAGAGAATCACAGTTTCTAATGGCGAAAAAAAATTTCAACACAAATCTGCTGGAATAG Translation Sequence: MSPSLQEGAQ LGENKPSTCS FSIERILGLD QKKDCVPLMK PHRPWADTCS SSGKDGNLCLHVPNPPSGIS FPSVVDHPMP EERASKYENY FSASERLSLK RELSWYRGRR PRTAFTQNQIEVLENVFRVN CYPGIDIRED LAQKLNLEED RIQIWFQNRR AKLKRSHRES QFLMAKKNFNTNLLE Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 037380
Form: Supplied as a lyophilized powder.