OCIAD2 is a protein that localizes to endosomes and contains one OCIA (Ovarian carcinoma immunoreactive antigen) domain. Diseases associated with OCIAD2 include ovarian mucinous neoplasm. An important paralog of this gene is OCIAD1. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 465bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCTTCAGCGTCTGCTCGTGGAAACCAAGATAAAGATGCCCATTTTCCACCACCAAGCAAGCAGAGCCTGTTGTTTTGTCCAAAATCAAAACTGCACATCCACAGAGCAGAGATCTCAAAGATTATGCGAGAATGTCAGGAAGAAAGTTTCTGGAAGAGAGCTCTGCCTTTTTCTCTTGTAAGCATGCTTGTCACCCAGGGACTAGTCTACCAAGGTTATTTGGCAGCTAATTCTAGATTTGGATCATTGCCCAAAGTTGCACTTGCTGGTCTCTTGGGATTTGGCCTTGGAAAGGTATCATACATAGGAGTATGCCAGAGTAAATTCCATTTTTTTGAAGATCAGCTCCGTGGGGCTGGTTTTGGTCCACAGCATAACAGGCACTGCCTCCTTACCTGTGAGGAATGCAAAATAAAGCATGGATTAAGTGAGAAGGGAGACTCTCAGCCTTCAGCTTCCTAA Translation Sequence: MASASARGNQ DKDAHFPPPS KQSLLFCPKS KLHIHRAEIS KIMRECQEES FWKRALPFSL VSMLVTQGLV YQGYLAANSR FGSLPKVALA GLLGFGLGKV SYIGVCQSKF HFFEDQLRGA GFGPQHNRHC LLTCEECKIK HGLSEKGDSQ PSAS Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.