OMP (Olfactory marker protein) is uniquely associated with the mature olfactory receptor neurons in many vertebrate species from fish to man. The OMP gene structure and protein sequence are highly conserved between mouse, rat and human. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 492bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGGAGGACAGGCCGCAGCAGCCGCAGCTGGACATGCCGCTGGTCCTGGACCAGGGCCTGACCAGGCAGATGCGGCTACGCGTGGAGAGCCTGAAGCAGCGCGGGGAGAAGCGCCAGGATGGGGAGAAGCTGCTGCAGCCAGCGGAGTCTGTGTACCGCCTCAACTTCACCCAGCAGCAGCGGCTACAGTTCGAGCGCTGGAATGTCGTGCTGGACAAGCCGGGCAAGGTCACCATCACAGGCACCTCGCAGAACTGGACGCCTGACCTCACCAACCTCATGACACGCCAGCTGCTGGACCCCACTGCCATCTTCTGGCGCAAGGAGGACTCGGATGCCATAGATTGGAATGAGGCCGACGCCCTGGAGTTTGGGGAGCGCCTGTCGGACCTGGCCAAGATCCGCAAGGTCATGTACTTCCTCGTCACCTTTGGCGAGGGTGTGGAGCCCGCCAACCTCAAGGCCTCCGTGGTTTTTAACCAGCTCTGA Translation Sequence: MAEDRPQQPQ LDMPLVLDQG LTRQMRLRVE SLKQRGEKRQ DGEKLLQPAE SVYRLNFTQQ QRLQFERWNV VLDKPGKVTI TGTSQNWTPD LTNLMTRQLL DPTAIFWRKE DSDAIDWNEA DALEFGERLS DLAKIRKVMY FLVTFGEGVE PANLKASVVF NQL Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.