PDZD11 is a cytosolic protein which contains one PDZ (DHR) domain. It is ubiquitously expressed, and appears to target calcium and copper ATPases to basolateral cell membranes. It is a transiently interacting partner of the PMCA b-splice forms that may play a role in their sorting to or from the plasma membrane. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 423bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGACAGCCGGATTCCTTATGATGACTACCCGGTGGTTTTCTTGCCTGCCTATGAGAATCCTCCAGCATGGATTCCTCCTCATGAGAGGGTACACCACCCGGACTACAACAATGAGTTGACCCAGTTTCTGCCCCGAACCATCACACTGAAGAAGCCTCCTGGAGCTCAGTTGGGATTTAACATCCGAGGAGGAAAGGCCTCCCAGCTAGGCATCTTCATCTCCAAGGTGATTCCTGACTCTGATGCACATAGAGCAGGACTGCAGGAAGGGGACCAAGTTCTAGCTGTGAATGATGTGGATTTCCAAGATATTGAGCACAGCAAGGCTGTTGAGATCCTGAAGACAGCTCGTGAAATCAGCATGCGTGTGCGCTTCTTTCCCTACAATTATCATCGCCAAAAAGAGAGGACTGTGCACTAG Translation Sequence: MDSRIPYDDY PVVFLPAYEN PPAWIPPHER VHHPDYNNEL TQFLPRTITL KKPPGAQLGFNIRGGKASQL GIFISKVIPD SDAHRAGLQE GDQVLAVNDV DFQDIEHSKA VEILKTAREISMRVRFFPYN YHRQKERTVH Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
