POLE3 cDNA

Catalog Number: USB-552181
Article Name: POLE3 cDNA
Biozol Catalog Number: USB-552181
Supplier Catalog Number: 552181
Alternative Catalog Number: USB-552181-10
Manufacturer: US Biological
Category: Molekularbiologie
POLE3 is a histone-fold protein that interacts with other histone-fold proteins to bind DNA in a sequence-independent manner. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 444bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGGAGAGGCCCGAGGACCTAAACCTGCCCAATGCCGTGATCACCAGGATCATCAAGGAGGCGCTCCCGGACGGTGTCAACATCTCCAAGGAGGCCCGGAGCGCCATCTCCCGCGCCGCCAGCGTCTTCGTGCTGTACGCCACATCCTGTGCTAACAACTTTGCAATGAAAGGAAAGCGGAAGACGCTGAATGCCAGTGATGTGCTCTCAGCCATGGAAGAGATGGAGTTCCAGCGGTTCGTTACCCCATTGAAAGAAGCTCTGGAAGCATATAGGCGGGAGCAGAAAGGCAAGAAGGAGGCCTCAGAGCAAAAGAAGAAGGACAAAGACAAAAAAACAGACTCGGAAGAGCAAGACAAGAGCAGGGATGAGGACAATGATGAAGACGAAGAAAGGCTGGAAGAAGAAGAACAGAATGAAGAGGAAGAAGTAGACAACTGA Translation Sequence: MAERPEDLNL PNAVITRIIK EALPDGVNIS KEARSAISRA ASVFVLYATS CANNFAMKGKRKTLNASDVL SAMEEMEFQR FVTPLKEALE AYRREQKGKK EASEQKKKDK DKKTDSEEQDKSRDEDNDED EERLEEEEQN EEEEVDN Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 059139
Form: Supplied as a lyophilized powder.