POLR2E encodes the fifth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit is shared by the other two DNA-directed RNA polymerases and is present in two-fold molar excess over the other polymerase subunits. An interaction between this subunit and a hepatitis virus transactivating protein has been demonstrated, suggesting that interaction between transcriptional activators and the polymerase can occur through this subunit. A pseudogene is located on chromosome 11. Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 633bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGACGACGAGGAGGAGACGTACCGGCTCTGGAAAATCCGCAAGACCATCATGCAGCTGTGCCACGACCGTGGCTATCTGGTGACCCAGGACGAGCTTGACCAGACCCTGGAGGAGTTCAAAGCCCAATTTGGGGACAAGCCGAGTGAGGGGCGGCCGCGGCGCACGGACCTCACCGTGCTGGTGGCCCACAACGATGACCCCACCGACCAGATGTTTGTGTTCTTTCCAGAGGAGCCCAAGGTGGGCATCAAGACCATCAAGGTGTACTGCCAGCGCATGCAGGAGGAGAACATCACACGGGCTCTCATCGTGGTGCAGCAGGGCATGACACCCTCCGCCAAGCAGTCCCTGGTCGACATGGCCCCCAAGTACATCCTGGAGCAGTTTCTGCAGCAGGAGCTGCTCATCAACATCACGGAGCACGAGCTAGTCCCTGAGCACGTCGTCATGACCAAGGAGGAGGTGACAGAGCTGCTGGCCCGATATAAGCTCCGAGAGAACCAGCTGCCCAGGATCCAGGCGGGGGACCCTGTGGCGCGCTACTTTGGGATAAAGCGTGGGCAGGTGGTGAAGATCATCCGGCCCAGTGAGACGGCTGGCAGGTACATCACCTACCGGCTGGTGCAGTAG Translation Sequence: MDDEEETYRL WKIRKTIMQL CHDRGYLVTQ DELDQTLEEF KAQFGDKPSE GRPRRTDLTV LVAHNDDPTD QMFVFFPEEP KVGIKTIKVY CQRMQEENIT RALIVVQQGM TPSAKQSLVD MAPKYILEQF LQQELLINIT EHELVPEHVV MTKEEVTELL ARYKLRENQL PRIQAGDPVA RYFGIKRGQV VKIIRPSETA GRYITYRLVQ Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.