POLR2I encodes a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit, in combination with two other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. The product of this gene has two zinc finger motifs with conserved cysteines and the subunit does possess zinc binding activity. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 378bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGAGCCCGACGGGACTTACGAGCCGGGCTTCGTGGGTATTCGCTTCTGCCAGGAATGTAACAACATGCTGTACCCCAAGGAAGACAAGGAGAACCGCATTCTGCTCTACGCGTGCCGGAACTGTGATTACCAGCAGGAGGCCGACAACAGCTGCATCTATGTCAACAAGATCACGCACGAAGTGGACGAACTGACCCAGATTATCGCCGACGTGTCCCAGGACCCCACGTTGCCGCGGACCGAGGACCACCCGTGCCAAAAGTGCGGCCACAAGGAGGCTGTGTTCTTCCAGTCACACAGTGCGCGGGCCGAGGACGCCATGCGCCTTTACTACGTGTGCACAGCCCCACACTGCGGCCACCGCTGGACCGAGTGA Translation Sequence: MEPDGTYEPG FVGIRFCQEC NNMLYPKEDK ENRILLYACR NCDYQQEADN SCIYVNKITH EVDELTQIIA DVSQDPTLPR TEDHPCQKCG HKEAVFFQSH SARAEDAMRL YYVCTAPHCG HRWTE Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
