POLR2J cDNA

Catalog Number: USB-552185
Article Name: POLR2J cDNA
Biozol Catalog Number: USB-552185
Supplier Catalog Number: 552185
Alternative Catalog Number: USB-552185-10
Manufacturer: US Biological
Category: Molekularbiologie
POLR2J encodes a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene exists as a heterodimer with another polymerase subunit, together they form a core subassembly unit of the polymerase. Two similar genes are located nearby on chromosome 7q22. 1 and a pseudogene is found on chromosome 7p13. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 354bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAACGCCCCTCCAGCCTTCGAGTCGTTCTTGCTCTTCGAGGGCGAGAAGAAGATCACCATTAACAAGGACACCAAGGTACCCAATGCCTGTTTATTCACCATCAACAAAGAAGACCACACACTGGGAAACATCATTAAATCACAACTCCTAAAAGACCCGCAAGTGCTATTTGCTGGCTACAAAGTCCCCCACCCCTTGGAGCACAAGATCATCATCCGAGTGCAGACCACGCCGGACTACAGCCCCCAGGAAGCCTTTACCAACGCCATCACCGACCTCATCAGTGAGCTGTCCCTGCTGGAGGAGCGCTTTCGGGTGGCCATAAAAGACAAGCAGGAAGGAATTGAGTAG Translation Sequence: MNAPPAFESF LLFEGEKKIT INKDTKVPNA CLFTINKEDH TLGNIIKSQL LKDPQVLFAG YKVPHPLEHK IIIRVQTTPD YSPQEAFTNA ITDLISELSL LEERFRVAIK DKQEGIE Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 006225
Form: Supplied as a lyophilized powder.