PPP1R14D (protein phosphatase 1, regulatory (inhibitor) subunit 14D), also known as GBPI-1 (gastrointestinal and brain-specific PP1-inhibitory protein 1), belongs to the PP1 inhibitor family and is one of three CPI-17 homologs in the human genome. PPP1R14D gene maps to human chromosome 15q15. 1. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 438bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCTGTCTTCAAGCCCTGCTTCCTGCACATCTCCCAGCCCAGATGGGGAGAACCCATGTAAGAAGGTCCACTGGGCTTCTGGGAGGAGAAGGACATCATCCACAGACTCAGAGTCCAAGTCCCACCCGGACTCCTCCAAGATACCCAGGTCCCGGAGACCCAGCCGCCTGACAGTGAAGTATGACCGGGGCCAGCTCCAGCGCTGGCTGGAGATGGAGCAATGGGTGGATGCTCAAGTTCAGGAGCTCTTCCAGGATCAAGCAACCCCTTCTGAGCCTGAGATTGACCTGGAAGCTCTCATGGATCTATCCACAGAGGAGCAGAAGACTCAGCTGGAGGCCATTCTTGGGAACTGCCCCCGCCCCACAGAGGCTTTTATCTCTGAGCTGCTCAGTCAACTCAAGAAACTCCGGAGACTCAGCCGGCCTCAGAAATAA Translation Sequence: MLSSSPASCT SPSPDGENPC KKVHWASGRR RTSSTDSESK SHPDSSKIPR SRRPSRLTVK YDRGQLQRWL EMEQWVDAQV QELFQDQATP SEPEIDLEAL MDLSTEEQKT QLEAILGNCP RPTEAFISEL LSQLKKLRRL SRPQK Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.