PPP1R1B cDNA

Catalog Number: USB-552192
Article Name: PPP1R1B cDNA
Biozol Catalog Number: USB-552192
Supplier Catalog Number: 552192
Alternative Catalog Number: USB-552192-10
Manufacturer: US Biological
Category: Molekularbiologie
PPP1R1B encodes a bifunctional signal transduction molecule. Dopaminergic and glutamatergic receptor stimulation regulates its phosphorylation and function as a kinase or phosphatase inhibitor. As a target for dopamine, this gene may serve as a therapeutic target for neurologic and psychiatric disorders. Multiple transcript variants encoding different isoforms have been found for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 615bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGACCCCAAGGACCGCAAGAAGATCCAGTTCTCGGTGCCCGCGCCCCCTAGCCAGCTCGACCCCCGCCAGGTGGAGATGATCCGGCGCAGGAGACCAACGCCTGCCATGCTGTTCCGGCTCTCAGAGCACTCCTCACCAGAGGAGGAAGCCTCCCCCCACCAGAGAGCCTCAGGAGAGGGGCACCATCTCAAGTCGAAGAGACCCAACCCCTGTGCCTACACACCACCTTCGCTGAAAGCTGTGCAGCGCATTGCTGAGTCTCACCTGCAGTCTATCAGCAATTTGAATGAGAACCAGGCCTCAGAGGAGGAGGATGAGCTGGGGGAGCTTCGGGAGCTGGGTTATCCAAGAGAGGAAGATGAGGAGGAAGAGGAGGATGATGAAGAAGAGGAAGAAGAAGAGGACAGCCAGGCTGAAGTCCTGAAGGTCATCAGGCAGTCTGCTGGGCAAAAGACAACCTGTGGCCAGGGTCTGGAAGGGCCCTGGGAGCGCCCACCCCCTCTGGATGAGTCCGAGAGAGATGGAGGCTCTGAGGACCAAGTGGAAGACCCAGCACTAAGTGAGCCTGGGGAGGAACCTCAGCGCCCTTCCCCCTCTGAGCCTGGCACATAG Translation Sequence: MDPKDRKKIQ FSVPAPPSQL DPRQVEMIRR RRPTPAMLFR LSEHSSPEEE ASPHQRASGE GHHLKSKRPN PCAYTPPSLK AVQRIAESHL QSISNLNENQ ASEEEDELGE LRELGYPREE DEEEEEDDEE EEEEEDSQAE VLKVIRQSAG QKTTCGQGLE GPWERPPPLD ESERDGGSED QVEDPALSEP GEEPQRPSPS EPGT Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 115568
Form: Supplied as a lyophilized powder.