PSMD9 acts as a chaperone during the assembly of the 26S proteasome, specifically of the base subcomplex of the PA700/19S regulatory complex (RC). During the base subcomplex assembly is part of an intermediate PSMD9:PSMC6:PSMC3 module, also known as modulator trimer complex, PSMD9 is released during the further base assembly process. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 672bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCCGACGAGGAAGCGAGGCAGAGCGGAGGCTCCTCGCAGGCCGGCGTCGTGACTGTCAGCGACGTCCAGGAGCTGATGCGGCGCAAGGAGGAGATAGAAGCGCAGATCAAGGCCAACTATGACGTGCTGGAAAGCCAAAAAGGCATTGGGATGAACGAGCCGCTGGTGGACTGTGAGGGCTACCCCCGGTCAGACGTGGACCTGTACCAAGTCCGCACCGCCAGGCACAACATCATATGCCTGCAGAATGATCACAAGGCAGTGATGAAGCAGGTGGAGGAGGCCCTGCACCAGCTGCACGCTCGCGACAAGGAGAAGCAGGCCCGGGACATGGCTGAGGCCCACAAAGAGGCCATGAGCCGCAAACTGGGTCAGAGTGAGAGCCAGGGCCCTCCACGGGCCTTCGCCAAAGTGAACAGCATCAGCCCCGGCTCCCCAGCCAGCATCGCGGGTCTGCAAGTGGATGATGAGATTGTGGAGTTCGGCTCTGTGAACACCCAGAACTTCCAGTCACTGCATAACATTGGCAGTGTGGTGCAGCACAGTGAGGGGAAGCCCCTGAATGTGACAGTGATCCGCAGGGGGGAAAAACACCAGCTTAGACTTGTTCCAACACGCTGGGCAGGAAAAGGACTGCTGGGCTGCAACATTATTCCTCTGCAAAGATGA Translation Sequence: MSDEEARQSG GSSQAGVVTV SDVQELMRRK EEIEAQIKAN YDVLESQKGI GMNEPLVDCEGYPRSDVDLY QVRTARHNII CLQNDHKAVM KQVEEALHQL HARDKEKQAR DMAEAHKEAMSRKLGQSESQ GPPRAFAKVN SISPGSPASI AGLQVDDEIV EFGSVNTQNF QSLHNIGSVVQHSEGKPLNV TVIRRGEKHQ LRLVPTRWAG KGLLGCNIIP LQR Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
