RAB1A cDNA

Catalog Number: USB-552205
Article Name: RAB1A cDNA
Biozol Catalog Number: USB-552205
Supplier Catalog Number: 552205
Alternative Catalog Number: USB-552205-10
Manufacturer: US Biological
Category: Molekularbiologie
RAB1A encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multiple alternatively spliced transcript variants have been identified for this gene which encode different protein isoforms. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 618bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGTCTTGCCTTCTTCTTAGGTTTGCAGATGATACATATACAGAAAGCTACATCAGCACAATTGGTGTGGATTTCAAAATAAGAACTATAGAGTTAGACGGGAAAACAATCAAGCTTCAAATATGGGACACAGCAGGCCAGGAAAGATTTCGAACAATCACCTCCAGTTATTACAGAGGAGCCCATGGCATCATAGTTGTGTATGATGTGACAGATCAGGAGTCCTTCAATAATGTTAAACAGTGGCTGCAGGAAATAGATCGTTATGCCAGTGAAAATGTCAACAAATTGTTGGTAGGGAACAAATGTGATCTGACCACAAAGAAAGTAGTAGACTACACAACAGCGAAGGAATTTGCTGATTCCCTTGGAATTCCGTTTTTGGAAACCAGTGCTAAGAATGCAACGAATGTAGAACAGTCTTTCATGACGATGGCAGCTGAGATTAAAAAGCGAATGGGTCCCGGAGCAACAGCTGGTGGTGCTGAGAAGTCCAATGTTAAAATTCAGAGCACTCCAGTCAAGCAGTCAGGTGGAGGTTGCTGCTAA Translation Sequence: MSSMNPEYDY LFKLLLIGDS GVGKSCLLLR FADDTYTESY ISTIGVDFKI RTIELDGKTIKLQIWDTAGQ ERFRTITSSY YRGAHGIIVV YDVTDQESFN NVKQWLQEID RYASENVNKLLVGNKCDLTT KKVVDYTTAK EFADSLGIPF LETSAKNATN VEQSFMTMAA EIKKRMGPGATAGGAEKSNV KIQSTPVKQS GGGCC Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 004152
Form: Supplied as a lyophilized powder.