The protein encoded by RAB2A belongs to the Rab family, members of which are small molecular weight guanosine triphosphatases (GTPases) that contain highly conserved domains involved in GTP binding and hydrolysis. The Rabs are membrane-bound proteins, involved in vesicular fusion and trafficking. This protein is a resident of pre-Golgi intermediates, and is required for protein transport from the endoplasmic reticulum (ER) to the Golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 639bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGGCGTACGCCTATCTCTTCAAGTACATCATAATCGGCGACACAGGTGTTGGTAAATCATGCTTATTGCTACAGTTTACAGACAAGAGGTTTCAGCCAGTGCATGACCTTACTATTGGTGTAGAGTTCGGTGCTCGAATGATAACTATTGATGGGAAACAGATAAAACTTCAGATATGGGATACGGCAGGGCAAGAATCCTTTCGTTCCATCACAAGGTCGTATTACAGAGGTGCAGCAGGAGCTTTACTAGTTTACGATATTACACGGAGAGATACATTCAACCACTTGACAACCTGGTTAGAAGATGCCCGCCAGCATTCCAATTCCAACATGGTCATTATGCTTATTGGAAATAAAAGTGATTTAGAATCTAGAAGAGAAGTAAAAAAAGAAGAAGGTGAAGCTTTTGCACGAGAACATGGACTCATCTTCATGGAAACGTCTGCTAAGACTGCTTCCAATGTAGAAGAGGCATTTATTAATACAGCAAAAGAAATTTATGAAAAAATTCAAGAAGGAGTCTTTGACATTAATAATGAGGCAAATGGCATTAAAATTGGCCCTCAGCATGCTGCTACCAATGCAACACATGCAGGCAATCAGGGAGGACAGCAGGCTGGGGGCGGCTGCTGTTGA Translation Sequence: MAYAYLFKYI IIGDTGVGKS CLLLQFTDKR FQPVHDLTIG VEFGARMITI DGKQIKLQIW DTAGQESFRS ITRSYYRGAA GALLVYDITR RDTFNHLTTW LEDARQHSNS NMVIMLIGNK SDLESRREVK KEEGEAFARE HGLIFMETSA KTASNVEEAF INTAKEIYEK IQEGVFDINN EANGIKIGPQ HAATNATHAG NQGGQQAGGG CC Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
