RAB34 encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. This gene overlaps and shares exon structure with the nine-amino acid residue-repeats (NARR) gene, which encodes a functionally distinct nucleolar protein from a different reading frame. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 780bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAACATTCTGGCACCCGTGCGGAGGGATCGCGTCCTGGCGGAGCTGCCCCAGTGCCTGAGGAAGGAGGCCGCTTTGCACGGGCACAAAGACTTCCACCCCCGCGTCACCTGCGCCTGCCAGGAGCACCGGACAGGCACCGTGGGATTTAAGATCTCCAAGGTCATTGTGGTGGGGGACCTGTCGGTGGGGAAGACTTGCCTCATTAATAGGTTCTGCAAAGACACCTTTGATAAGAATTACAAGGCCACCATTGGAGTGGACTTCGAGATGGAACGATTTGAGGTGCTGGGCATTCCCTTCAGTTTGCAGCTTTGGGATACCGCTGGGCAGGAGAGGTTCAAATGCATTGCATCAACCTACTATAGAGGAGCTCAAGCCATCATCATTGTCTTCAACCTGAATGATGTGGCATCTCTGGAACATACCAAGCAGTGGCTGGCCGATGCCCTGAAGGAGAATGACCCTTCCAGTGTGCTTCTCTTCCTTGTAGGTTCCAAGAAGGATCTGAGTACCCCTGCTCAGTATGCGCTGATGGAGAAAGACGCCCTCCAGGTGGCCCAGGAGATGAAGGCTGAGTACTGGGCAGTCTCATCTCTCACTGGTGAGAATGTCCGAGAATTCTTCTTCCGTGTGGCAGCACTGACCTTTGAGGCCAATGTGCTGGCTGAGCTGGAGAAATCGGGGGCTCGACGCATTGGGGATGTTGTCCGCATCAACAGTGATGACAGCAACCTCTACCTAACTGCCAGCAAGAAGAAGCCCACATGTTGCCCATGA Translation Sequence: MNILAPVRRD RVLAELPQCL RKEAALHGHK DFHPRVTCAC QEHRTGTVGF KISKVIVVGD LSVGKTCLIN RFCKDTFDKN YKATIGVDFE MERFEVLGIP FSLQLWDTAG QERFKCIAST YYRGAQAIII VFNLNDVASL EHTKQWLADA LKENDPSSVL LFLVGSKKDL STPAQYALME KDALQVAQEM KAEYWAVSSL TGENVREFFF RVAALTFEAN VLAELEKSGA RRIGDVVRIN SDDSNLYLTA SKKKPTCCP Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
