RAB4A cDNA

Catalog Number: USB-552215
Article Name: RAB4A cDNA
Biozol Catalog Number: USB-552215
Supplier Catalog Number: 552215
Alternative Catalog Number: USB-552215-10
Manufacturer: US Biological
Category: Molekularbiologie
RAB4A is a member of the largest group in the Ras superfamily of small GTPases, which regulate membrane trafficking. The encoded protein is associated with early endosomes and is involved in their sorting and recycling. The protein also plays a role in regulating the recycling of receptors from endosomes to the plasma membrane. Alternatively spliced transcript variants have been observed for this gene. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 657bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCGCAGACGGCCATGTCCGAAACCTACGATTTTTTGTTTAAGTTCTTGGTTATTGGAAATGCAGGAACTGGCAAATCTTGCTTACTTCATCAGTTTATTGAAAAAAAATTCAAAGATGACTCAAATCATACAATAGGAGTGGAATTTGGTTCAAAGATAATAAATGTTGGTGGTAAATATGTAAAGTTACAAATATGGGATACAGCAGGACAAGAACGATTCAGGTCCGTGACGAGAAGTTATTACCGAGGCGCGGCCGGGGCTCTCCTCGTCTATGATATCACCAGCCGAGAAACCTACAATGCGCTTACTAATTGGTTAACAGATGCCCGAATGCTAGCGAGCCAGAACATTGTGATCATCCTTTGTGGAAACAAGAAGGACCTGGATGCAGATCGTGAAGTTACCTTCTTAGAAGCCTCCAGATTTGCTCAAGAAAATGAGCTGATGTTTTTGGAAACAAGTGCGCTCACAGGGGAGAATGTAGAAGAGGCTTTTGTACAGTGTGCAAGAAAAATACTTAACAAAATCGAATCAGGTGAGCTGGACCCAGAAAGAATGGGCTCAGGTATTCAGTACGGAGATGCTGCCTTGAGACAGCTGAGGTCACCGCGGCGCGCACAGGCCCCGAACGCTCAGGAGTGTGGTTGTTAG Translation Sequence: MSQTAMSETY DFLFKFLVIG NAGTGKSCLL HQFIEKKFKD DSNHTIGVEF GSKIINVGGK YVKLQIWDTA GQERFRSVTR SYYRGAAGAL LVYDITSRET YNALTNWLTD ARMLASQNIV IILCGNKKDL DADREVTFLE ASRFAQENEL MFLETSALTG ENVEEAFVQC ARKILNKIES GELDPERMGS GIQYGDAALR QLRSPRRAQA PNAQECGC Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 004569
Form: Supplied as a lyophilized powder.