RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. RAB7A encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded RAB7A is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in RAB7A have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 624bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTTATCATCCTGGGAGATTCTGGAGTCGGGAAGACATCACTCATGAACCAGTATGTGAATAAGAAATTCAGCAATCAGTACAAAGCCACAATAGGAGCTGACTTTCTGACCAAGGAGGTGATGGTGGATGACAGGCTAGTCACAATGCAGATATGGGACACAGCAGGACAGGAACGGTTCCAGTCTCTCGGTGTGGCCTTCTACAGAGGTGCAGACTGCTGCGTTCTGGTATTTGATGTGACTGCCCCCAACACATTCAAAACCCTAGATAGCTGGAGAGATGAGTTTCTCATCCAGGCCAGTCCCCGAGATCCTGAAAACTTCCCATTTGTTGTGTTGGGAAACAAGATTGACCTCGAAAACAGACAAGTGGCCACAAAGCGGGCACAGGCCTGGTGCTACAGCAAAAACAACATTCCCTACTTTGAGACCAGTGCCAAGGAGGCCATCAACGTGGAGCAGGCGTTCCAGACGATTGCACGGAATGCACTTAAGCAGGAAACGGAGGTGGAGCTGTACAACGAATTTCCTGAACCTATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCGGCAGAAAGCTGCAGTTGCTGA Translation Sequence: MTSRKKVLLK VIILGDSGVG KTSLMNQYVN KKFSNQYKAT IGADFLTKEV MVDDRLVTMQIWDTAGQERF QSLGVAFYRG ADCCVLVFDV TAPNTFKTLD SWRDEFLIQA SPRDPENFPFVVLGNKIDLE NRQVATKRAQ AWCYSKNNIP YFETSAKEAI NVEQAFQTIA RNALKQETEVELYNEFPEPI KLDKNDRAKA SAESCSC Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.