RBM3 is a member of the glycine-rich RNA-binding protein family and encodes a protein with one RNA recognition motif (RRM) domain. Expression of this gene is induced by cold shock and low oxygen tension. A pseudogene exists on chromosome 1. Multiple alternatively spliced transcript variants that are predicted to encode different isoforms have been characterized although some of these variants fit nonsense-mediated decay (NMD) criteria. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 474bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGTCCTCTGAAGAAGGAAAGCTCTTCGTGGGAGGGCTCAACTTTAACACCGACGAGCAGGCACTGGAAGACCACTTCAGCAGTTTCGGACCTATCTCTGAGGTGGTCGTTGTCAAGGACCGGGAGACTCAGCGGTCCAGGGGTTTTGGTTTCATCACCTTCACCAACCCAGAGCATGCTTCAGTTGCCATGAGAGCCATGAACGGAGAGTCTCTGGATGGTCGTCAGATCCGTGTGGATCATGCAGGCAAGTCTGCTCGGGGAACCAGAGGAGGTGGCTTTGGGGCCCATGGGCGTGGTCGCAGCTACTCTAGAGGTGGTGGGGACCAGGGCTATGGGAGTGGCAGGTATTATGACAGTCGACCTGGAGGGTATGGATATGGATATGGACGTTCCAGAGACTATAATGGCAGAAACCAGGGTGGTTATGACCGCTACTCAGGAGGAAATTACAGAGACAATTATGACAACTGA Translation Sequence: MSSEEGKLFV GGLNFNTDEQ ALEDHFSSFG PISEVVVVKD RETQRSRGFG FITFTNPEHA SVAMRAMNGE SLDGRQIRVD HAGKSARGTR GGGFGAHGRG RSYSRGGGDQ GYGSGRYYDS RPGGYGYGYG RSRDYNGRNQ GGYDRYSGGN YRDNYDN Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
