RBPMS encodes a member of the RNA recognition motif family of RNA-binding proteins. The RNA recognition motif consists of two short stretches of conserved sequence, as well as a few highly conserved hydrophobic residues. The encoded protein has a single, putative RNA recognition motif in its N-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 591bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGAACAACGGCGGCAAAGCCGAGAAGGAGAACACCCCGAGCGAGGCCAACCTTCAGGAGGAGGAGGTCCGGACCCTATTTGTCAGTGGCCTTCCTCTGGATATCAAACCTCGGGAGCTCTATCTGCTTTTCAGACCATTTAAGGGCTATGAGGGTTCTCTTATAAAGCTCACATCTAAACAGCCTGTAGGTTTTGTCAGTTTTGACAGTCGCTCAGAAGCAGAGGCTGCAAAGAATGCTTTGAATGGCATCCGCTTCGATCCTGAAATTCCGCAAACACTACGACTAGAGTTTGCTAAGGCAAACACGAAGATGGCCAAGAACAAACTCGTAGGGACTCCAAACCCCAGTACTCCTCTGCCCAACACTGTACCTCAGTTCATTGCCAGAGAGCCATATGAGCTCACAGTGCCTGCACTTTACCCCAGTAGCCCTGAAGTGTGGGCCCCGTACCCTCTGTACCCAGCGGAGTTAGCGCCTGCTCTACCTCCTCCTGCTTTCACCTATCCCGCTTCACTGCATGCCCAGATGCGCTGGCTCCCTCCCTCCGAGGCTACTTCTCAGGGCTGGAAGTCCCGTCAGTTCTGCTGA Translation Sequence: MNNGGKAEKE NTPSEANLQE EEVRTLFVSG LPLDIKPREL YLLFRPFKGY EGSLIKLTSK QPVGFVSFDS RSEAEAAKNA LNGIRFDPEI PQTLRLEFAK ANTKMAKNKL VGTPNPSTPL PNTVPQFIAR EPYELTVPAL YPSSPEVWAP YPLYPAELAP ALPPPAFTYP ASLHAQMRWL PPSEATSQGW KSRQFC Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
