RPL12 cDNA

Catalog Number: USB-552248
Article Name: RPL12 cDNA
Biozol Catalog Number: USB-552248
Supplier Catalog Number: 552248
Alternative Catalog Number: USB-552248-10
Manufacturer: US Biological
Category: Molekularbiologie
RPS12 is a ribosomal protein that is a component of the 60S subunit and belongs to the L11P family of ribosomal proteins. It is located in the cytoplasm. This gene is co-transcribed with the U65 snoRNA, which is located in its fourth intron. Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector. cDNA Size: 498bp Preparation before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid. Nucleotide Sequence: ATGCCGCCGAAGTTCGACCCCAACGAGATCAAAGTCGTATACCTGAGGTGCACCGGAGGTGAAGTCGGTGCCACTTCTGCCCTGGCCCCCAAGATCGGCCCCCTGGGTCTGTCTCCAAAAAAAGTTGGTGATGACATTGCCAAGGCAACGGGTGACTGGAAGGGCCTGAGGATTACAGTGAAACTGACCATTCAGAACAGACAGGCCCAGATTGAGGTGGTGCCTTCTGCCTCTGCCCTGATCATCAAAGCCCTCAAGGAACCACCAAGAGACAGAAAGAAACAGAAAAACATTAAACACAGTGGGAATATCACTTTTGATGAGATTGTCAACATTGCTCGACAGATGCGGCACCGATCCTTAGCCAGAGAACTCTCTGGAACCATTAAAGAGATCCTGGGGACTGCCCAGTCAGTGGGCTGTAATGTTGATGGCCGCCATCCTCATGACATCATCGATGACATCAACAGTGGTGCTGTGGAATGCCCAGCCAGTTAA Translation Sequence: MPPKFDPNEI KVVYLRCTGG EVGATSALAP KIGPLGLSPK KVGDDIAKAT GDWKGLRITV KLTIQNRQAQ IEVVPSASAL IIKALKEPPR DRKKQKNIKH SGNITFDEIV NIARQMRHRS LARELSGTIK EILGTAQSVG CNVDGRHPHD IIDDINSGAV ECPAS Storage and Stability: Lyophilized and reconstituted products are stable for 6 months after receipt at -20C. Reconstitute with sterile ddH2O. Aliquot to avoid repeated freezing and thawing. Store at -20C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap.
NCBI: 000967
Form: Supplied as a lyophilized powder.